Descifrando el código genético: reproducción de un descubrimiento científico Teach article

Traducido por Amparo Andrés-Pons. En 1953 James Watson y Francis Crick descubrieron la estructura del ADN, la molécula portadora de nuestra información genética.

En 1958 Crick postuló el dogma central de la biología molecular: El flujo de información va desde el ADN al ARN, y del ARN a las proteínas.  Sin embargo, quedaba una cuestión por resolver: ¿Cómo puede el alfabeto de cuatro letras del ADN (A, C, T y G) o sus equivalentes en el ARN (A, C, U y G) codificar el alfabeto de 20 letras de los aminoácidos que forman nuestras proteínas?

En 1961 Marshall W Nirenberg y Johann H Matthaei descifraron la primera letra del código; averiguaron que la secuencia de ARN UUU codifica el aminoácido fenilalanina. Posteriormente, Har Gobind Khorana demostró que la secuencia repetitiva de nucleótidos UCUCUCUCUCUC codifica la secuencia de aminoácidos serina-leucina-serina-leucina. En 1965, principalmente gracias al trabajo de Nirenberg y Khorana, el código genético había sido completamente descifrado. Se encontró que cada grupo de tres nucleótidos (conocidos como codones) corresponde a un aminoácido, y que el orden de los codones determina el orden de los aminoácidos en la proteína resultante (y, por tanto, sus propiedades químicas y biológicas).

Imagen cortesía de Caroline Davis2010; Origen de la imagen: flickr 

 

¿Cómo descifraron el código genético Nirenberg y Khorana?

Nirenberg y Khorana compararon pequeñas secuencias del ácido nucleico ARN con las secuencias de aminoácidos resultantes (péptidos). Para ello siguieron el protocolo que Nirenberg desarrolló junto a Matthaei.

Sintetizaron artificialmente una secuencia específica de nucleótidos de ARN y la mezclaron con extractos de la bacteria Escherichia coli que contenían ribosomas y otros componentes de la maquinaria celular necesarios para la síntesis de proteínas. A continuación, los científicos repartieron la mezcla resultante en 20 muestras. A cada muestra le añadieron un aminoácido marcado radiactivamente y los 19 aminoácidos restantes sin marcar, y dejaron que la síntesis de proteínas tuviera lugar. Si el péptido resultante era radiactivo, significaría que contenía el aminoácido marcado radiactivamente, lo cual indicaría que la secuencia de nucleótidos de ARN codificaba dicho aminoácido.

Repitiendo este experimento con diferentes secuencias de ARN fueron recolectando más y más información sobre el código genético. Después de haber testado las secuencias más simples, como UUUUUU y AAAAAA, otros grupos de científicos continuaron con el desafío de analizar secuencias de ARN más complejas. Así, finalmente, se pudieron descodificar los 64 codones.

El código genético per se es un elemento crucial en las lecciones de biología, ya que explica desde el punto de vista molecular las acciones de los genes (por ejemplo, en relación a las mutaciones, la evolución y la expresión génica). Además, la forma en que Nirenberg y Khorana descifraron el código genético – comparando cortas secuencias de ARN con las secuencias de aminoácidos resultantes – puede ser utilizada en la escuela como una actividad de enseñanza basada en la indagación. Utilizando las secuencias proporcionadas por el profesor, los alumnos trabajan en grupos para:

  • Identificar patrones
  • Generar hipótesis y modelos explicativos
  • Diseñar experimentos
  • Formular conclusiones a partir de datos parciales
  • Determinar la solidez de sus conclusiones
  • Comunicar y justificar sus conclusiones de manera científica

La actividad, por tanto, es un modelo para la enseñanza de la naturaleza del conocimiento científico: un consenso provisional generado por la comunidad con conclusiones de diversa solidez basado en evidencias parciales.

Descifrando el código genético en el aula

Esta actividad es adecuada para alumnos de 14 a 18 años trabajando en grupos de 3 o 4, y requiere unas dos horas repartidas en cuatro bloques más una discusión final. Está diseñada como una introducción a la biología molecular, antes de que el profesor explique el código genético o el dogma central de la biología molecular.

Los alumnos deben descifrar un código compuesto por diferentes secuencias de las letras A, C, T y G utilizando los mensajes que codifican esas secuencias (por ejemplo, AspHisTrp…). En cada uno de los tres primeros pasos, se reparte a cada grupo un set de secuencias de letras y los mensajes correspondientes. En cada paso, los alumnos deben revaluar sus conclusiones de los pasos anteriores y modificar su solución al código.

Explícales que todos los grupos trabajarán para descifrar el mismo código utilizando diferentes ejemplos. No les menciones la naturaleza biológica de las secuencias (ADN y aminoácidos); deben centrarse en encontrar patrones y relaciones.

Nirenberg y Khorana utilizaron secuencias de ARN para descifrar el código; en cambio, esta actividad utiliza secuencias de ADN (codones en sentido 5′ a 3′). El quid de la actividad es la existencia del código, no los detalles de la transcripción y traducción, los cuales pueden ser tratados en lecciones posteriores.

Después de cada paso de la actividad, puedes pedirle a un alumno de cada grupo que se pase a otro grupo. (Esto refleja la dinámica de cómo el conocimiento científico se adquiere y se comparte, por ejemplo, en los congresos o a través de las publicaciones).

Si no, puedes decirles que los grupos sólo pueden intercambiar información cuando se les dé permiso. (Si un grupo se queda atascado y se desanima, puede ser más sencillo pedir ayuda a otro grupo en vez de al profesor).

Materiales

  • Hojas de ejercicios 1-4 para cada grupo, que se pueden descargar en la columna de la derecha. Los sets de secuencias son diferentes para cada grupo.
  • Figura 1 o una aplicación para teléfonos inteligentes para convertir fácilmente los codones de ADN a aminoácidosw1.
Figura 1. El código genético. Para descifrar un codón de ADN (5′ a 3′), busca la primera letra de tu secuencia en el círculo interno y muévete hacia fuera para identificar el aminoácido correspondiente. Por ejemplo, CAT codifica el aminoácido H (histidina).
Imagen cortesía de Cath Brooksbank

Procedimiento

Deja al menos 10-15 minutos para que los estudiantes puedan discutir cada apartado. Cuando todos los grupos consideren que han obtenido toda la información posible sobre sus secuencias, pasa al siguiente apartado.

  1. Detectar pautas. Reparte a cada grupo una copia de la hoja de ejercicios 1, que contiene tres secuencias sin codones sinónimos ni codones de parada. Todas las secuencias empiezan con un triplete ATG, el cual codifica el aminoácido metionina (Met).
    Utilizando las tres secuencias, los alumnos deberán establecer que el código se basa en tripletes de letras y generar las primeras hipótesis sobre el significado de algunos de estos tripletes.

    Tabla 1. Un ejemplo de la hoja de ejercicios 1
    Secuencia Mensaje Los estudiantes encontraron que…
    ATGTTAGGTAGTAAAGATGCT MetLeuGlySerLysAspAla El código está basado en tripletes, y cada triplete representa uno de los elementos de tres letras, por ejemplo Met.
    ATGCATGAAGCTATTTATGAT MetHisGluAlaIleTyrAsp
    ATGGGTAGTGATGAAGCTTAT MetGlySerAspGluAlaTyr
  2. Generar un modelo. Da a cada grupo una copia de la hoja de ejercicios 2, que contiene tres secuencias nuevas, algunas de las cuales contienen codones sinónimos.
    Los estudiantes deberán confirmar algunas de sus hipótesis del apartado 1, a la vez que podrán poner en duda otras de sus hipótesis.

    Tabla 2. Ejemplo de las secuencias de uno de los grupos para el apartado 2
    Secuencia Mensaje Los estudiantes encontraron que…
    ATGGTTTCGTACACTGCGTCA MetValSerTyrThrAlaSer Algunos elementos son codificados por más de un triplete, por ejemplo, Ser.
    ATGCCGTACACATGTGTCACA MetProTyrThrCysValThr
    ATGACGAGTGCGTTGTGCGAT MetThrSerAlaLeuCysAsp
  3. Ajustar el modelo a las nuevas evidencias. Reparte a cada grupo una copia de la hoja de ejercicios 3, la cual contiene nuevas secuencias de mayor complejidad: algunas secuencias carecen del codón inicial ATG, otras lo contienen en medio de la secuencia, y otras contienen un codón de terminación. Estas características hacen que los mensajes sean más cortos que las secuencias de 7 aminoácidos de los apartados anteriores, o bien no generan ningún mensaje.
    La hoja de ejercicios para este apartado contiene dos listas de secuencias. Puedes elegir entre dar a los alumnos todas las secuencias a la vez (para que este apartado sea más sencillo) o repartirlas en dos subapartados (para complicar más este bloque).
    Además de confirmar que estos tripletes codifican algunos aminoácidos, estas secuencias permitirán a los alumnos identificar los papeles clave del codón de la metionina (codón de inicio) y de los codones de parada.

    Tabla 3. Ejemplo de las secuencias de uno de los grupos para el apartado 3
    Secuencia Mensaje Los estudiantes encontraron que…
    TGTCATGCATCCGTCATCACTGAC El triplete ATG determina el principio del mensaje y el triplete TGA, el final.
    TGCGTGACTATGGACACAGTCGT MetAspThrVal
    ATGTGTCGATGACTGATCATG MetCysArg
    ATGTGCGTACACATTTGAGTC MetCysValHisIle
    ATGCTGTACACATGATGCACAGT MetLeuTyrThr
  4. Testar hipótesis y diseñar experimentos. Los alumnos deberían ser capaces en este momento de proponer una solución parcial para su código. Para comprobar sus hipótesis, reparte a cada grupo una copia de la hoja de ejercicios 4 y pídeles que diseñen un experimento. Deberán proponer cambios en cuatro secuencias específicas que recibieron en los apartados anteriores, y apuntar cualquier cambio que esperen en el mensaje. Entonces dales el mensaje correcto, utilizando la figura 1 si fuera necesario. ¿Es el resultado que ellos esperaban? En caso negativo, ¿qué les indica esto? Este experimento mimetiza el proceso de generación de hipótesis, diseño de experimentos y análisis de los resultados.
    Como conclusión de la actividad, cada grupo debe presentar su descodificación parcial al resto de la clase justificando sus conclusiones. Las  partes del código que sean aceptadas por el resto del grupo – que representa la comunidad científica – se escribirán en la pizarra. Las partes controvertidas o que no estén claras también se deben apuntar. El resultado será un código genético parcial y consensuado.
    Evita confirmar inmediatamente si el código construido por los estudiantes es correcto. Explícales que, en ciencia, no hay un libro con el que comparar tus resultados, sino que la única forma de averiguar si algo es correcto es planteándose buenas preguntas, diseñando buenos experimentos, y compartiendo la información e ideas con tus colegas para llegar a un consenso.

Discusión

Estudiantes comparando
datos nuevos con las
conclusiones de los
apartados anteriores.

Imagen cortesía de Jordi
Domènech-Casal

Pide a tus alumnos que se planteen las siguientes preguntas:

  • ¿Cómo descubristeis lo que sabéis ahora?
  • ¿Habéis discutido vuestras ideas con alguien durante la actividad? ¿Qué discutisteis?
  • ¿Cómo comprobasteis si vuestras hipótesis eran correctas?
  • ¿Eliminasteis alguna de vuestras hipótesis iniciales? ¿Cuáles?
  • ¿Cómo resolvisteis los casos de conclusiones contradictorias dentro de un mismo grupo o entre grupos?
  • ¿Fueron todas vuestras conclusiones igual de sólidas?

Después de esta discusión, explica a tus alumnos que las secuencias eran secuencias de ADN y aminoácidos, y que ellos acaban de reproducir un experimento real clave para la biología molecular. Los estudiantes deberían estar motivados ahora para aprender más sobre el código genético y el dogma central de la biología molecular. Destaca lo similar que es la actividad que acaban de realizar a la forma en la que se descubrió el código genético en la realidad.

Puedes finalizar la actividad recordando a tus alumnos lo que han descubierto por sí mismos:

  • En el apartado 1, que el código genético se basa en tripletes de nucleótidos (codones).
  • En el apartado 2, que el código genético es redundante pero no es ambiguo: cada codón codifica un elemento único (por ejemplo, un aminoácido), pero algunos elementos están codificados por más de un codón.
  • En el apartado 3, que el código incluye codones de inicio y de parada para especificar el principio y el final de las secuencias de aminoácidos.

(Ten en cuenta que la actividad podría generar la concepción errónea de que las proteínas están formadas normalmente por seis o siete aminoácidos. Es posible que haya que explicarles este punto correctamente.)

Explica a tus alumnos que la forma en la que han estado trabajando, en grupos que colaboran y/o compiten, con algunos miembros de los grupos que van cambiando, y compartiendo información con otros grupos, refleja la forma en la que los científicos trabajan en la vida real.

Adaptaciones

Para hacer la actividad más fácil, puedes dar a tus alumnos más secuencias en cada apartado (por ejemplo, los sets de secuencias para dos grupos). Alternativamente, podrías saltarte el apartado 3, y simplemente explicar la función de los codones de inicio y de parada después de la actividad.

Agradecimientos

Las observaciones pedagógicas de la actividad descrita en este artículo forman parte del trabajo del grupo de investigación sobre lenguaje y contextos en educación para la ciencia (Llenguatge i Contextos en Educació Científica, LICEC) de la Universidad Autónoma de Barcelona (referencia 2014SGR1492), financiado por el Ministerio Español de Economía y Competitividad (referencia EDU2015-66643-C2-1-P).

Download

Download this article as a PDF

Web References

Resources

  • Esta actividad es parte del proyecto C3 de enseñanza de las ciencias, que desarrolla actividades para la enseñanza de la ciencia basadas en la indagación en el currículo académico.
  • Otras actividades en español en el proyecto se refieren a la tectónica de placas, mitosis y cáncer, la evolución humana, la filogenia, la herencia genética, la expresión génica y la dinámica de ecosistemas.
  • Ver también:
  • Domènech-Casal J (2013) Hacking the code: una aproximació indagadora a l’ensenyament del codi genètic, o seguint les passes de Nirenberg i Khorana. Ciències: revista del professorat de ciències de primària i secundària 25: 20-25
  • Domènech-Casal J (in press) Proyectando BioGeo, un itinerario de trabajo por proyectos contextualizados basado en la indagación y la Naturaleza de la Ciencia. Alambique, Didáctica de las Ciencias Experimentales
  • Nirenberg M, et al (1965) RNA codewords and protein synthesis, VII. On the general nature of the RNA code. Proceedings of the National Academy of Sciences of the USA 53(5): 1161–1168
  • El artículo (en inglés) puede ser descargado gratuitamente de la página web Pubmed Central.
  • Lee la historia ‘How the code was cracked’ en la página web oficial de los Premios Nobel.
  • En 1968 Marshall W. Nirenberg, Har Gobind Khorana y Robert W. Holley fueron galardonados con el Premio Nobel de Fisiología o Medicina «por su interpretación del código genético y su función en la síntesis de proteínas». Los detalles de su trabajo están descritos en su discurso de aceptación.
  • Francis Crick, James Watson y Maurice Wilkins fueron galardonados con el Premio Nobel de Fisiología o Medicina en 1962 por ‘sus descubrimientos concernientes a la estructura molecular de los ácidos nucleicos y su importancia para la transferencia de información en la materia viva’. 
  • En 1970 Francis Crick describió cómo se llegó a desarrollar el dogma central de la biología molecular.  
  • Crick F (1970) Central dogma of molecular biology. Nature 227: 561-563. doi:10.1038/227561a0
  • Muchos artículos escritos por Crick están disponibles gratuitamente en la página web de Nature. www.nature.com

Author(s)

Jordi Domènech-Casal es Doctor en Biología, y trabajó durante ocho años como investigador en genética y química inorgánica en las universidades de Barcelona (España), Bolonia (Italia) y París VII (Francia). Actualmente trabaja como profesor de ciencias en el Institut de Granollers, una escuela de educación secundaria en Barcelona, y como instructor de profesores y asesor en enseñanza de las ciencias para el gobierno catalán y el proyecto europeo “Engaging science”. Es además miembro del grupo de investigación de lenguaje y enseñanza de las ciencias (Llenguatge i ensenyament de les ciències, LIEC) de la Universidad Autónoma de Barcelona, donde se centra en el papel del lenguaje y el contexto en actividades de aprendizaje basadas en la indagación y en proyectos para la enseñanza de las ciencias.


Review

Este artículo ofrece ayuda a los profesores para explorar, de forma simple y accesible, uno de los aspectos más complicados de la enseñanza de las ciencias: ayudar a sus alumnos a apreciar y entender cómo funciona la ciencia realmente. La adquisición de conocimientos requiere que los científicos se planteen buenas preguntas, diseñen y lleven a cabo buenos experimentos, y trabajen juntos para gestionar las incertidumbres. Esto es exactamente lo que los estudiantes han de hacer en esta actividad para descifrar el código genético.

Anticipo que este artículo será útil también para profesores de otras disciplinas diferentes a la biología (especialmente matemáticas y química). Sería también una muy buena actividad para realizar en una feria de ciencias.


Betina Lopes, Portugal




License

CC-BY
CC BY