Η αποκρυπτογράφηση του γενετικού κώδικα: αναπαράγοντας μια επιστημονική ανακάλυψη. Teach article

Μετάφραση από: Νεφέλη Γαρούφη (Nefeli Garoufi) – Φοιτήτρια Βιολογίας, ΕΚΠΑ και Παναγιώτη Κ. Στασινάκη (Panagiotis K. Stasinakis) - Εκπαιδευτικός, Βιολόγος, MEd, PhD, Πανελλήνια Ένωση…

Το 1958, ο Crick διατύπωσε το κεντρικό δόγμα της μοριακής βιολογίας: η ροή της πληροφορίας μεταφέρεται από το DNA στο RNA και τέλος στην πρωτεΐνη. Όμως, το ερώτημα παρέμενε: πώς το αλφάβητο των τεσσάρων-γραμμάτων των νουκλεοτιδίων του DNA (A, C, T, G) ή το αντίστοιχο του RNA (A, C, U, G) κωδικοποιούσε το αλφάβητο είκοσι-γραμμάτων των αμινοξέων που απαρτίζουν τις πρωτεΐνες; Ποιός ήταν ο γενετικός κώδικας; 

Το 1961, οι Marshall W Nirenberg και Johann H Matthaei αποκρυπτογράφησαν το πρώτο γράμμα του κώδικα, αποκαλύπτοντας ότι η αλληλουχία UUU του RNA κωδικοποιεί το αμινοξύ φαινυλαλανίνη. Ακολούθως, ο Har Gobind Khorana έδειξε ότι η επαναλαμβανόμενη νουκλεοτιδική αλληλουχία UCUCUCUCUCUC κωδικοποιεί μία εναλλασσόμενη σειρά αμινοξέων, σερίνη-λευκίνη-σερίνη-λευκίνη. Μέχρι το 1965, κυρίως χάρη στο έργο των Nirenberg και Khorana, ο γενετικός κώδικας είχε αποκρυπτογραφηθεί πλήρως. Η αποκρυπτογράφηση αποκάλυψε ότι κάθε ομάδα τριών νουκλεοτιδίων (γνωστά και ως κωδικόνια) κωδικοποιούν ένα συγκεκριμένο αμινοξύ, και ότι η σειρά των κωδικονίων καθορίζει την αλληλουχία των αμινοξέων στις τελικές πρωτεΐνες και, συνεπώς, τις χημικές και βιολογικές ιδιότητες τους

Ευγενική χορηγία εικόνας από: Caroline Davis2010.
Πηγή εικόνας: flickr

 

Πώς αποκρυπτογράφησαν το γενετικό κώδικα οι Nirenberg και Khorana;

Οι Nirenberg και Khorana συνέκριναν μικρές αλληλουχίες του νουκλεϊκού οξέος RNA και των αλληλουχιών των αμινοξέων που προέκυψαν (πεπτίδια). Για να το κάνουν αυτό, ακολούθησαν το πρωτόκολλο που είχε σχεδιάσει ο Nirenberg με τον Matthae

Αυτό συμπεριλάμβανε την τεχνητή σύνθεση μίας συγκεκριμένης αλληλουχίας από RNA νουκλεοτίδια και την ανάμειξή τους με εκχυλίσματα βακτηρίων Escherichia coli, που περιέχουν ριβοσώματα και άλλους κυτταρικούς μηχανισμούς απαραίτητους για την πρωτεϊνοσύνθεση. Οι επιστήμονες, τότε, ετοίμασαν 20 δείγματα του τελικού μείγματος. Σε κάθε δείγμα πρόσθεσαν ένα ραδιενεργά ιχνηθετημένο αμινοξύ και 19 μη-ιχνηθετημένα αμινοξέα και, στη συνέχεια, επέτρεψαν να γίνει η πρωτεϊνοσύνθεση. Κάθε ένα από τα 20 δείγματα περιείχε ένα διαφορετικό ραδιενεργά ιχνηθετημένο αμινοξύ. Αν το πεπτίδιο που σχηματίζονταν ήταν ραδιενεργό, αυτό θα σήμαινε ότι περιείχε το ραδιενεργά ιχνηθετημένο αμινοξύ, επιβεβαιώνοντας ότι η RNA νουκλεοτιδική αλληλουχία κωδικοποιούσε σε κάποιο σημείο το εν λόγω αμινοξύ.

Με συνεχείς επαναλήψεις αυτού του πειράματος με διαφορετικές RNA αλληλουχίες, συγκεντρώνονταν όλο και περισσότερες πληροφορίες για τον γενετικό κώδικα. Αφού είχαν δοκιμαστεί απλές αλληλουχίες, όπως UUUUUU και AAAAAA, περισσότερες επιστημονικές ομάδες δέχτηκαν την πρόκληση, αναλύοντας πιο περίπλοκες αλληλουχίες RNA, επιτρέποντας, με την πάροδο του χρόνου, την αποκωδικοποίηση και των 64 κωδικονίων.

Ο γενετικός κώδικας είναι από μόνος του ένα σημαντικό στοιχείο στο μάθημα της βιολογίας, παρέχοντας μία μοριακή εξήγηση για τις δράσεις των γονιδίων (για παράδειγμα, για τη μετάλλαξη, την εξέλιξη και τη γονιδιακή έκφραση). Επιπλέον, ο τρόπος με τον οποίον οι Nirenberg και Khorana έσπασαν τον γενετικό κώδικα –συγκρίνοντας μικρές αλληλουχίες RNA με τις προκύψασες αλληλουχίες αμινοξέων- μπορεί να επαναληφθεί ως ερευνητικό ερώτημα (διερευνητική μάθηση) σε μία σχολική δραστηριότητα. Χρησιμοποιώντας τις αλληλουχίες που τους παρέχονται από τον διδάσκοντα, οι μαθητές θα δουλέψουν σε ομάδες ώστε να: 

  • Ταυτοποιήσουν μοτίβα
  • Κατασκευάσουν υποθέσεις και επεξηγητικά μοντέλα
  • Σχεδιάσουν πειράματα
  • Φτάσουν σε συμπεράσματα από μερικά δεδομένα
  • Εδραιώσουν την ισχύ των συμπερασμάτων τους
  • Γνωστοποιήσουν και δικαιολογήσουν τα συμπεράσματά τους με επιστημονικό τρόπο.

Η δραστηριότητα, έτσι, προσφέρει ένα μοντέλο για την διδασκαλία της φύσης της επιστημονικής γνώσης: μία προσωρινή γενική παραδοχή της κοινότητας με συμπεράσματα ποικίλης ισχύος, βασισμένη σε μερικά δεδομένα.

«Σπάζοντας» τον κώδικα στην τάξη

Αυτή η δραστηριότητα είναι κατάλληλη για μαθητές 14 – 18 χρονών, σε ομάδες των 3-4, και διαρκεί περίπου δύο ώρες, χωρισμένη σε τέσσερα στάδια, συν μίας τελικής συζήτησης. Είναι σχεδιασμένη ως μία εισαγωγή στη μοριακή βιολογία, πριν εξηγηθεί το οτιδήποτε σχετικά με τον γενετικό κώδικα ή το κεντρικό δόγμα της μοριακής βιολογίας.

Οι μαθητές ζητούνται να «σπάσουν» έναν κώδικα αποτελούμενο από διαφορετικές αλληλουχίες των γραμμάτων (Α, C, T, G), χρησιμοποιώντας τα μηνύματα που κωδικοποιούν (π.χ. AspHisTrp…) αυτοί οι κώδικες. Σε κάθε ένα από τα τρία πρώτα βήματα, δίνεται στην κάθε ομάδα ένα διαφορετικό σετ αλληλουχιών και τα αντίστοιχα μηνύματα. Σε κάθε βήμα, θα χρειαστεί να επανεκτιμήσουν τα συμπεράσματα των προηγούμενων βημάτων και να διαφοροποιήσουν τη λύση τους για τον κώδικα.

Εξηγείστε ότι όλες οι ομάδες θα δουλεύουν για να αποκρυπτογραφήσουν τον ίδιο κώδικα, χρησιμοποιώντας διαφορετικά παραδείγματα. Μην αναφέρετε στους μαθητές για τη βιολογική φύση των αλληλουχιών (DNA και αμινοξέα): θα πρέπει να συγκεντρωθούν στην εύρεση μοτίβων και σχέσεων. 

Οι Nirenberg και Khorana χρησιμοποίησαν αλληλουχίες RNA για την αποκρυπτογράφηση του κώδικα. Σε αντίθεση, η δραστηριότητα χρησιμοποιεί αλληλουχίες DNA (μεταγραφόμενο κωδικόνιο, με κατεύθυνση 5΄προς 3΄). Το κύριο σημείο της δραστηριότητας είναι η ύπαρξη του κώδικα παρά οι λεπτομέρειες της μεταγραφής και της μετάφρασης, οι οποίες μπορούν να συζητηθούν σε επόμενα μαθήματα.

Μετά από κάθε βήμα, μπορείτε να ζητήσετε από ένα μαθητή από κάθε ομάδα να γίνει μέλος μία διαφορετικής ομάδας. (Αυτό μιμείται τις σχέσεις του πώς η επιστημονική γνώση αποκτάται και μοιράζεται, για παράδειγμα σε συνέδρια ή μέσω δημοσιεύσεων). Αλλιώς, οι ομάδες μπορούν να ανταλλάξουν πληροφορίες μόνο όταν τους προτείνεται. (Αν μία ομάδα κολλήσει και απογοητευθεί, μπορεί ρωτώντας κάποια άλλη ομάδα αντί του καθηγητή, να προκαλέσει καλύτερη κινητοποίηση).

Υλικά

  • Φύλλα εργασίας, 1-4 για κάθε ομάδα, τα οποία μπορούν να ληφθούν από τη στήλη στα δεξιά. Τα σετ των αλληλουχιών είναι διαφορετικά για κάθε ομάδα.
  • Εικόνα 1 ή μία εφαρμογή έξυπνου κινητού για εύκολη μετατροπή των κωδικονίων DNA σε αμινοξέαw1.
Εικόνα 1: Ο γενετικός κώδικας. Για την αποκωδικοποίηση ενός μεταγραφόμενου DNA κωδικονίου, βρείτε το πρώτο γράμμα της αλληλουχίας σας στον εσωτερικό κύκλο και μετακινηθείτε προς τα έξω για να αναγνωρίσετε τα αντίστοιχα αμινοξέα. Για παράδειγμα, CAT κωδικόνια για H (ιστιδίνη).
Ευγενική χορηγία εικόνας από: Cath Brooksbank

Διαδικασία

Αφήστε τουλάχιστον 10-15 λεπτά στους μαθητές σας, για να συζητήσουν το κάθε βήμα. Όταν όλες οι ομάδες αισθάνονται πως έχουν λάβει όλες τις δυνατές πληροφορίες από τις αλληλουχίες τους, προχωρήστε στο επόμενο βήμα.

  1. Εντοπισμός πλαισίων. Δώστε σε κάθε ομάδα ένα φύλλο εργασίας 1, το οποίο περιέχει τρεις αλληλουχίες που δεν περιέχουν συνώνυμα κωδικόνια ή κωδικόνια λήξης. Όλες οι αλληλουχίες ξεκινούν με ένα ATG κωδικόνιο, κωδικοποιώντας το αμινοξύ μεθειονίνη (Met).
    Χρησιμοποιώντας τις τρεις αλληλουχίες, οι μαθητές θα μπορέσουν να αποδείξουν ότι ο κώδικας βασίζεται σε τριπλέτες γραμμάτων και να κάνουν την πρώτη τους υπόθεση για το νόημα κάποιων από αυτών.
     

    Πίνακας 1: Ένα παράδειγμα του φύλλου εργασίας 1
    Αλληλουχία Μήνυμα Οι μαθητές ανακάλυψαν ότι…
    ATGTTAGGTAGTAAAGATGCT MetLeuGlySerLysAspAla Ο κώδικας βασίζεται σε τριπλέτες και η κάθε τριπλέτα αντιπροσωπεύει ένα από τα στοιχεία τριών γραμμάτων, π.χ. Met.
    ATGCATGAAGCTATTTATGAT MetHisGluAlaIleTyrAsp
    ATGGGTAGTGATGAAGCTTAT MetGlySerAspGluAlaTyr
  2. Κατασκευή ενός μοντέλου. Δώστε σε κάθε ομάδα ένα φύλλο εργασίας 2, το οποίο περιέχει τρεις νέες αλληλουχίες, κάποιες από τις οποίες περιέχουν συνώνυμα κωδικόνια.
    Οι μαθητές θα πρέπει να μπορούν να επιβεβαιώσουν κάποιες από τις υποθέσεις που έκαναν στο 1ο βήμα και να αμφισβητήσουν κάποιες άλλες.
     

    Πίνακας 2: Ένα παράδειγμα αλληλουχίας μίας εκ των ομάδων για το 2ο βήμα
    Αλληλουχία Μήνυμα Οι μαθητές ανακάλυψαν ότι…
    ATGGTTTCGTACACTGCGTCA MetValSerTyrThrAlaSer Κάποια στοιχεία μπορούν να κωδικοποιηθούν από περισσότερες από μία τριπλέτες, π.χ. Ser.
    ATGCCGTACACATGTGTCACA MetProTyrThrCysValThr
    ATGACGAGTGCGTTGTGCGAT MetThrSerAlaLeuCysAsp
  3. Προσαρμογή του μοντέλου σε νέα στοιχεία. Δώστε σε κάθε ομάδα ένα αντίγραφο του 3ου  φύλλου εργασιών, που περιλαμβάνει νέες αλληλουχίες που παρουσιάζουν περισσότερη περιπλοκότητα: σε κάποιες αλληλουχίες λείπει το αρχικό AΤG κωδικόνιο, κάποιες άλλες το εμφανίζουν αργότερα στην αλληλουχία, και κάποιες έχουν ένα κωδικόνιο λήξης. Αυτά τα χαρακτηριστικά, είτε έχουν ως αποτέλεσμα ότι τα μηνύματα έχουν μικρότερο μήκος από τις επτά αμινοξικές αλληλουχίες των προηγούμενων βημάτων ή δεν παράγουν καν κάποιο μήνυμα.
    Τα κάθε φύλλα εργασίας για αυτό το βήμα, περιέχουν δύο λίστες αλληλουχιών. Μπορείτε να επιλέξετε αν θα δώσετε στους μαθητές όλες τις αλληλουχίες μαζί (για να κάνετε αυτό το βήμα ευκολότερο) ή σε δύο ξεχωριστά υπο-βήματα (για να το κάνετε δυσκολότερο).
    Πέραν του να επιβεβαιώσουν τις τριπλέτες που κωδικοποιούν κάποια αμινοξέα, αυτές οι αλληλουχίες επιτρέπουν στους μαθητές να αναγνωρίσουν τους βασικούς ρόλους της μεθειονίνης (έναρξη) και των κωδικονίων λήξης
     

    Πίνακας 3: Ένα παράδειγμα αλληλουχίας μίας ομάδας για το 3ο βήμα
    Αλληλουχία Μήνυμα Οι μαθητές ανακάλυψαν ότι…
    TGTCATGCATCCGTCATCACTGAC Η ATG τριπλέτα καθορίζει την αρχή του μηνύματος και ότι η TGA τριπλέτα το τέλος της.
    TGCGTGACTATGGACACAGTCGT MetAspThrVal
    ATGTGTCGATGACTGATCATG MetCysArg
    ATGTGCGTACACATTTGAGTC MetCysValHisIle
    ATGCTGTACACATGATGCACAGT MetLeuTyrThr
  4. Έλεγχος της υπόθεσης και σχεδιασμός πειραμάτων. Οι μαθητές θα πρέπει πλέον να μπορούν να προτείνουν μία μερική λύση στον κώδικα. Για να ελέγξουν τις υποθέσεις τους, δώστε σε κάθε ομάδα ένα αντίγραφο του φύλλου εργασίας 4 και ζητήστε τους να σχεδιάσουν ένα πείραμα. Θα πρέπει να προτείνουν αλλαγές σε τέσσερις συγκεκριμένες αλληλουχίες που τους δόθηκαν στα προηγούμενα βήματα και να σημειώσουν τις αλλαγές που θα ανέμεναν στο μήνυμα. Στη συνέχεια, θα πρέπει να τους δώσετε το σωστό μήνυμα, χρησιμοποιώντας την Εικόνα 1, αν είναι απαραίτητο. Ήταν το αποτέλεσμα αυτό που περίμεναν; Αν όχι, τι τους λέει αυτό; Αυτό μιμείται μία ταχεία διαδικασία υπόθεσης, σχεδιασμού πειραμάτων και ανάλυσης αποτελεσμάτων.
    Ως κατακλείδα στη δραστηριότητα, κάθε ομάδα θα μπορούσε να παρουσιάσει τη δική της μερική λύση του κώδικα στην υπόλοιπη τάξη, υποστηρίζοντας τα συμπεράσματά της. Αυτά τα κομμάτια του κώδικα που θα γίνουν αποδεκτά από την υπόλοιπη τάξη -που αντιπροσωπεύει την επιστημονική κοινότητα – θα γραφτούν στον πίνακα. Αμφιλεγόμενα ή ασαφή κομμάτια θα πρέπει επίσης να συζητηθούν. Το αποτέλεσμα θα είναι ένας συναινετικός, εν μέρει γενετικός κώδικας.
    Να αποφύγετε την άμεση επιβεβαίωση για το αν ο κώδικας που έχουν κατασκευάσει οι μαθητές σας είναι σωστός. Εξηγήστε ότι στην επιστήμη δεν υπάρχει βιβλίο για να συγκρίνουν τα αποτελέσματά τους, και ότι ο μόνος τρόπος να βρουν αν κάτι είναι σωστό είναι με το να θέτουν καλά ερωτήματα, να σχεδιάζουν καλά πειράματα και να μοιράζονται πληροφορίες και ιδέες με τους ομότιμούς τους για να φτάσουν σε μία συναίνεση.

Συζήτηση

Μαθητές που συγκρίνουν
νέα δεδομένα με τα
συμπεράσματά τους από τα
προηγούμενα βήματα.

Ευγενική χορηγία εικόνας
από: Jordi Domènech-Casal

Ζητήστε από τους μαθητές σας να σκεφτούν τις παρακάτω ερωτήσεις

  • Πώς ανακαλύψατε όσα ξέρετε τώρα;
  • Συζητήσατε τις ιδέες σας με κάποιον κατά τη διάρκεια της δραστηριότητας; Τι συζητήσατε;
  • Πώς επιβεβαιώσατε αν η υπόθεσή σας ήταν σωστή;
  • Απορρίψατε κάποια από τις αρχικές σας υποθέσεις; Ποιες;
  • Πώς επιλύσατε αντιφατικά συμπεράσματα εντός ή και μεταξύ ομάδων;

Μετά τη συζήτηση, εξηγήστε στους μαθητές σας ότι οι αλληλουχίες ήταν αλληλουχίες DNA και αμινοξέων και ότι μόλις είχαν αναπαράγει ένα πολύ σημαντικό πείραμα της μοριακής βιολογίας. Οι μαθητές σας θα πρέπει να θέλουν, πλέον, να μάθουν περισσότερα για το γενετικό κώδικα και το κεντρικό δόγμα της μοριακής βιολογίας, συμπεριλαμβανομένου και το πόσο παρόμοια ήταν η δραστηριότητά τους με τον τρόπο με τον οποίο αποκρυπτογραφήθηκε ο γενετικός κώδικας.

Θα πρέπει να επαναλάβετε τη δραστηριότητα, υπενθυμίζοντας στους μαθητές σας αυτά που ανακάλυψαν οι ίδιοι: μαθητές σας αυτά που ανακάλυψαν οι ίδιοι:

  • Στο 1ο βήμα, ότι ο γενετικός κώδικας είναι βασισμένος σε τριπλέτες νουκλεοτιδίων (κωδικόνια).
  • Στο 2ο βήμα, ότι ο γενετικός κώδικας είναι εκφυλισμένος, αλλά όχι ασαφής: κάθε κωδικόνιο κωδικοποιεί ένα στοιχείο (π.χ. ένα αμινοξύ), αλλά κάποια στοιχεία κωδικοποιούνται από περισσότερα του ενός κωδικόνια.
  • Στο 3ο βήμα, ότι ο κώδικας περιλαμβάνει κωδικόνια έναρξης και λήξης για να σηματοδοτήσει την αρχή και το τέλος της κωδικοποιημένης αλληλουχίας αμινοξέων.

(Να σημειωθεί ότι η δραστηριότητα θα μπορούσε να προκαλέσει τη λάθος εντύπωση ότι οι πρωτεΐνες αποτελούνται, συνήθως, από έξι ή εφτά αμινοξέα, οπότε αυτό θα χρειαστεί να ξεκαθαριστεί).

Εξηγήστε ότι ο τρόπος εργασίας των μαθητών, σε συνεργαζόμενες ή/και ανταγωνιστικές ομάδες, με τα μέλη των ομάδων να αλλάζουν συνεχώς και με την ανταλλαγή πληροφοριών μεταξύ των ομάδων, αντικατοπτρίζει τον τρόπο με τον οποίο δουλεύουν οι επιστήμονες στην πραγματική ζωή.

Προσαρμογές

Για να κάνετε τη δραστηριότητα πιο εύκολη, μπορείτε να δώσετε στους μαθητές σας πιο πολλές αλληλουχίες σε κάθε βήμα (π.χ. τα σετ αλληλουχιών για τις δύο ομάδες). Εναλλακτικά, θα μπορούσατε να παραλείψετε το 3ο βήμα, και να εξηγήσετε με απλό τρόπο τους ρόλους των κωδικονίων έναρξης και λήξης μετά το πέρας της δραστηριότητας.

Ευχαριστίες

Οι παιδαγωγικοί προβληματισμοί σχετικά με τη δραστηριότητα που περιγράφεται σε αυτό το άρθρο αποτελούν μέρος της ερευνητικής ομάδας της γλώσσας και του πλαισίου της επιστημονικής εκπαίδευσης (llenguatge i contextos en educació científica, LICEC) του Autonomous University of Barcelona (αναφορά 2014SGR1492), που χρηματοδοτείται από το ισπανικό Υπουργείο Οικονομικών και Ανταγωνιστικότητας (αναφορά EDU2015-66643-C2-1-P).


Web References

Resources

Author(s)

Ο Jordi Domènech-Casal έχει διδακτορικό στη βιολογία και δούλεψε για οχτώ χρόνια ως ερευνητής στη γενετική και ανόργανη χημεία σε πανεπιστήμια της Βαρκελώνης στην Ισπανία, Μπολόνιας στην Ιταλία και Paris VII στη Γαλλία. Πλέον, εργάζεται ως διδάσκον βιολογίας στο Institut de Granollers, ένα γυμνάσιο στη Βαρκελώνη, και ως εκπαιδευτής εκπαιδευτικών και σύμβουλος για την παιδεία της επιστήμης για την κυβέρνηση της Καταλονίας και στο Ευρωπαϊκό πρόγραμμα «Πλησιάζοντας την Επιστήμη». Είναι μέλος της γλώσσας και του πλαισίου της επιστημονικής εκπαίδευσης (llenguatge i contextos en educació científica, LICEC) στο Autonomous University of Barcelona, όπου το ενδιαφέρον του επικεντρώνεται στο ρόλο της γλώσσας και του πλαισίου, στις μαθησιακές δραστηριότητες βασισμένες σε εργασίες και έρευνες στην παιδεία της επιστήμης.


Review

Αυτό το άρθρο προσφέρει μία στρατηγική που βοηθάει τους διδάσκοντες να εξερευνήσουν, απλά και με προσιτό τρόπο, ένα από τα πιο δύσκολα σημεία της επιστημονικής παιδείας: το να βοηθήσουν τους μαθητές τους να εκτιμήσουν και να κατανοήσουν πώς λειτουργεί πραγματικά η επιστήμη. Η απόκτηση γνώσης απαιτεί από τους επιστήμονες να θέτουν ορθά ερωτήματα, να σχεδιάζουν και να διεξάγουν καλά πειράματα και να συνεργάζονται για να αντιμετωπίσουν την αβεβαιότητα. Αυτό ακριβώς είναι που χρειάζεται να κάνουν οι μαθητές σε αυτή τη δραστηριότητα, για να σπάσουν το γενετικό κώδικα.

Αναμένω ότι οι διδάσκοντες αντικειμένων πέραν της βιολογίας (ιδιαίτερα μαθηματικών και χημείας) θα βρουν αυτό το άρθρο εξίσου βοηθητικό. Θα ήταν, επίσης, μία πολύ καλή δραστηριότητα για κάποια έκθεση επιστήμης.


Betina Lopes, Πορτογαλία




License

CC-BY
CC BY