Das Knacken des genetischen Codes: eine wissenschaftliche Entdeckung nachmachen Teach article

Übersetzt von Daniel Busch. Im Jahr 1953 entdeckten James Watson und Francis Crick die Struktur der DNA, dem Molekül das unsere genetischen Informationen trägt.

Im Jahr 1958 postulierte Crick dann das zentrale Dogma der Molekularbiologie: dass der Informationsfluss von DNA über RNA zum Protein abläuft. Die zentrale Frage blieb jedoch bestehen: wie codiert das Alphabet aus vier Buchstaben in der DNA (A, C, T und G) bzw. in ihrem Äquivalent der RNA (A, C, U und G) das Alphabet der zwanzig Buchstaben der Aminosäuren, die unsere Proteine bilden? Was war der genetische Code?

Im Jahr 1961 entzifferten Marshall W Nirenberg und Johann H Matthaei den ersten Buchstaben dieses Codes und enthüllten, dass die RNA-Sequenz UUU für die Aminosäure Phenylalanin codiert. Nachfolgend zeigte Har Gobind Khorana, dass die sich wiederholende Nucleotidsequenz UCUCUCUCUCUC für einen Strang der Aminosäuren Serin-Leucin-Serin-Leucin codiert. Im Jahr 1965 war der genetische Code größtenteils Dank der Arbeit von Nirenberg und Khorana vollständig entschlüsselt. Es konnte gezeigt werden, dass jede Gruppe von drei Nucleotiden (Codons gennant) für eine spezifische Aminosäure codiert, und dass die Reihenfolge der Codons die Reihenfolge der Aminosäuren des resultierenden Proteins festlegt (,und damit folglich auch dessen chemischen und biologischen Eigenschaften).

Mit freundlicher Genehmigung von Caroline Davis2010; Bildquelle: flickr

 

Wie knackten Nirenberg und Khorana den genetischen Code?

Nirenberg und Khorana verglichen kurze Sequenzen der Nukleinsäure RNA und die resultierenden Aminosäuresequenzen (Peptide). Dazu folgten Sie dem Protokoll, das Nirenberg zusammen mit Matthaei entwickelt hatte.

Dieses beinhaltete die künstliche Synthese einer spezifischen Sequenz von RNA-Nukleotiden und ihre Vermischung mit Extrakten von Escherichia coli Bakterien, die Ribosomen und andere zelluläre Strukturen enthielten, die für die Proteinsynthese nötig sind. Die Wissenschaftler bereiten dann 20 Proben der resultierenden Mischung vor, zu jeder Probe gaben sie eine radioaktiv markierte Aminosäure und 19 unmarkierte Aminosäuren, bevor sie die Proteinsynthese ablaufen ließen. Jede der 20 Probengefäße enthielt eine unterschiedliche, radioaktiv markierte Aminosäure. Wenn das resultierende Peptid radioaktiv markiert war, bedeutete das, dass die radioaktiv markierte Aminosäure einen Teil davon bildete, was wiederum bestätigte, dass die RNA-Nukleotidsequenz an irgendeiner Stelle für diese Aminosäure codierte.

Durch die Wiederholung dieses Experiments mit verschiedenen RNA-Sequenzen konnten mehr und mehr Informationen zum genetischen Code gesammelt werden. Nachdem einfach Sequenzen wie UUUUUU und AAAAAA getestet worden waren, namen sich andere Wissenschaftler der Herausforderung an, komplexere RNA-Sequenzen zu analysieren, was letztendlich zur Dekodierung aller 64 Codons führte.

Der genetische Code ist ein wesentliches Element des Biologieunterrichts, das eine molekulare Erklärung für das Verhalten von Genen liefert (z.B. bei Mutationen, in der Evolution und bei der Genexpression). Die Art und Weise, wie Nirenberg und Khorana den genetischen Code geknackt haben – nämlich durch den Vergleich kurzer RNA-Sequenzen mit den resultierenden Aminosäuresequenzen – kann des Weiteren als forschend-entdeckende Unterrichtsaktivität an Schulen nachgemacht werden. Unter Verwendung der Sequenzen, die vom Lehrer zur Verfügung gestellt werden, lernen die Schülerinnen und Schüler in Gruppen an:

  • Muster zu identifizieren
  • Hypothesen und Erklärmodelle aufzustellen
  • Experimente zu planen
  • Auswertungen anhand von Daten durchzuführen
  • Den Wert ihrer Auswertungen zu überprüfen
  • Ihre Auswertungen zu kommunizieren und in wissenschaftlicher Manier zu rechtfertigen

Die Aktivität bietet somit ein Unterrichtsmodell für die Natur des wissenschaftlichen Wissenserwerbs: ein provisorischer, von der Gemeinschaft konstruierter Konsens basierend auf vorläufigen Beweisen.

Das Knacken des Codes im Klassenzimmer

Diese Aktivität richtet sich an Schülerinnen und Schüler im Alter von 14-18, die in Dreier- oder Vierergruppen arbeiten, und beansprucht etwa zwei Stunden unterteilt in vier Schritte und einer Abschlussdiskussion. Sie wurde als eine Einführung in die Molekularbiologie erstellt, bevor der genetischen Code oder das zentrale Dogma der Molekularbiologie eingeführt wurden.

Von den Studenten wird erwartet, den Code aus verschiedenen Basensequenzen (A, C, T, G) zu entschlüsseln, wobei Ihnen die Informationen helfen, die diese Sequenzen codieren (z.B. Asp-His-Trp…). In jedem der drei ersten Schritte bekommt jede Gruppe einen unterschiedlichen Satz an Basensequenzen und korrespondierende Informationen. Mit jedem Schritt müssen sie ihre Ergebnisse der vorherigen Schritte erneut evaluieren und an den Code anpassen.

Erklären Sie allen Gruppen, dass sie den selben Code knacken, aber dafür verschiedene Beispiele verwenden. Erzählen Sie den Schülerinnen und Schülern nichts über die biologische Natur der Sequenzen (DNA und Aminosäuren); sie sollen sich darauf konzentrieren Muster und Gemeinsamkeiten zu finden.

Nirenberg und Khorana benutzten RNA-Sequenzen zum Knacken des Codes, im Gegensatz dazu greift diese Aktivität auf die DNA-Sequenzen (Sense Codon, 5’ zu 3’) zurück. Der Schlüssel der Aktivität ist eher die Existenz des Codes als die Details von Transkription und Translation, welche in den Folgestunden thematisiert werden können.

Nach jedem Arbeitsschritt könnten Sie eine/n Schüler/in bitten, sich einer anderen Gruppe anzuschließen. (Dies simuliert die Dynamik des wissenschaftlichen Wissenserwerbs und der Wissensweitergabe auf Konferenzen oder über Publikationen.)

Alternativ können die Gruppen ihr Wissen austauschen, wenn sie dazu aufgefordert werden. (Wenn eine Gruppe nicht weiterkommt und entmutigt wird, kann es motivierender sein, eine andere Gruppe um Rat zu fragen als den Lehrer.)

Materialien

  • Arbeitsblätter 1-4 für jede Gruppe. Sie können aus der rechten Spalte heruntergeladen werden. Die Sequenzsets sind für jede Gruppe anders.
  • Abbildung 1 oder eine Smartphone App für die einfache Umwandlung von DNA-Codons in Aminosäuren​w1.
Abbildung 1: Der genetische Code. Um ein Codon der Sense DNA zu dekodieren, musst du den ersten Buchstaben der Sequenz im inneren Kreis finden und dich nach außen arbeiten um die entsprechenden Aminosäuren zu identifizieren. CAT codiert beispielsweise für H (Histidin).
Mit freundlicher Genehmigung von Cath Brooksbank

Durchführung

Geben Sie ihren Schülerinnen und Schülern mindestens 10-15 Minuten Zeit für Diskussionen pro Arbeitsschritt. Wenn alle Gruppen das Gefühl haben, sich alle möglichen Informationen aus ihren Sequenzen erarbeitet zu haben, leiten Sie den nächsten Schritt ein.

  1. Rahmen erkennen. Geben Sie jeder Gruppe das Arbeitsblatt 1, welches drei Sequenzen aufweist, die weder synonyme Codons noch Stopp-Codons enthalten. All diese Sequenzen beginnen mit dem ATG-Codon, das für die Aminosäure Methionin (Met) codiert.
    Mithilfe der drei Codons sollten die Lernenden in der Lage sein, zu erkennen, dass der Code auf Basentripletts basiert und ihre erste Hypothese über die Bedeutung einiger Tripletts aufzustellen.

    Tabelle 1: Ein Beispiel für Arbeitsblatt 1
    Sequenz: Bedeutung Schülerinnen und Schüler erkennen, dass…
    ATGTTAGGTAGTAAAGATGCT MetLeuGlySerLysAspAla Der Code basiert auf Tripletts und jedes Triplett repräsentiert ein dreibuchstabiges Element, z.B. Met.
    ATGCATGAAGCTATTTATGAT MetHisGluAlaIleTyrAsp
    ATGGGTAGTGATGAAGCTTAT MetGlySerAspGluAlaTyr
  2. Ein Modell bauen. Geben Sie jedem Team eine Kopie von Arbeitsblatt 2, welches drei neue Sequenzen aufweist, von denen einige synonyme Codons beinhalten.
    Die Lernenden sollten in der Lage sein, einige ihrer Hypothesen aus Schritt 1 zu verifizieren, während andere Hypothesen angezweifelt warden müssten.

    Tabelle 2: Ein Beispiel für die Sequenz einer Gruppe für Schritt 2
    Sequenz Bedeutung Schülerinnen und Schüler erkennen, dass…
    ATGGTTTCGTACACTGCGTCA MetValSerTyrThrAlaSer einige Elemente von mehrern Tripletts codiert werden können, z.B. Ser.
    ATGCCGTACACATGTGTCACA MetProTyrThrCysValThr
    ATGACGAGTGCGTTGTGCGAT MetThrSerAlaLeuCysAsp
  3. Das Modell an neue Hinweise anpassen. Geben Sie jeder Gruppe eine Kopie von Arbeitsblatt 3, welches neue, komplexere Sequenzen beinhaltet: einigen Sequenzen fehlt das initiierende ATG-Codon, andere weisen e sim verlauf der Sequenz auf und andere haben ein Stopp-Codon. Diese Charakteristika resultieren entweder in Codes, die kürzer sind als die Sequenzen aus sieben Aminosäuren aus den vorherigen Arbeitsschritten, oder gar keine Bedeutung haben.
    Die Arbeitsblätter für diesen Schritt beinhalten jeweils zwei Listen von Sequenzen. Sie können auswählen, ob Sie den Lernenden alle Sequenzen zusammen aushändigen (um dieses Arbeitsschritt leichter zu machen) oder ob Sie sie in zwei Zwischenschritten ausgeben (um die Aufgabe schwerer zu machen).
    Zusätzlich zur Bestätigung, dass Tripletts einige Aminosäuren codieren, erlaubt es diese Sequenz den Lernenden die zentrale Rolle des Methionin- (Start-) und des Stopp-Codons zu identifizieren.

    Tabelle 3: Ein Beispiel für eine Sequenz einer Gruppe für Schritt 3
    Sequenz Bedeutung Schülerinnen und Schüler erkennen, dass…
    TGTCATGCATCCGTCATCACTGAC Das ATP-Triplett den Anfang des Codes darstellt und das TGA-Triplett sein Ende.
    TGCGTGACTATGGACACAGTCGT MetAspThrVal
    ATGTGTCGATGACTGATCATG MetCysArg
    ATGTGCGTACACATTTGAGTC MetCysValHisIle
    ATGCTGTACACATGATGCACAGT MetLeuTyrThr
  4. Das Testen der Hypothesen und das Planen von Experimenten. Die Lernenden sollten nun in der Lage sein, eine teilweise Lösung des Codes zu präsentieren. Um ihre Hypothesen zu testen, geben Sie jeder Gruppe eine Kopie von Arbeitsblatt 4 und fordern Sie sie auf, ein Experiment zu planen. Die Lernenden sollen Veränderungen an vier spezifischen Sequenzen aus den voherigen Arbeitsschritten vorschlagen und alle Veränderungen des Codes notieren, die sie erwarten. Danach geben Sie den Gruppen den korrekten Code, falls nötig verwenden Sie Abbildung 1. Entspricht das Resultat den Erwartungen? Falls nicht, was bedeutet das? Dieser Schritt imitiert einen schnellen Prozess von Hypothese, Versuchsdesign und Datenauswertung. Als Auswertung der Aktivität sollte jede Gruppe ihre Teillösung für den Code vor der Gesamtgruppe präsentieren und ihre Befunde rechtfertigen. Die Teile des Codes, die von dem Rest der Gruppe – hier für die wissenschaftliche Gemeinschaft stehend – akzeptiert werden, werden von Ihnen an der Tafel fixiert. Kontroverse oder unklare Anteile sollten ebenfalls notiert werden. Das Ergebnis wird ein akzeptierter, teilweise vollständiger genetischer Code sein.
    Vermeiden Sie es unbedingt, den Code, den ihre Lernenden erarbeitet haben, direkt als richtig zu bewerten. Erklären Sie stattdessen, dass es in der Wissenschaft kein Buch gibt, mit dem man seine Lösung vergleichen kann, und dass der einzige Weg herauszufinden, ob etwas richtig ist, das Stellen einer guten Frage, das Planen eines guten Experiments und das Teilen von Informationen und Ideen mit Gleichgesinnten ist, mit dem Ziel eines Konsenses.

Diskussion

Lernende vergleichen neue
Daten mit ihren Ergebnissen
aus früheren Arbeitsschritten

Mit freundlicher Genehmigung
von Jordi Domènech-Casal

Stellen Sie ihren Schülerinnen und Schüler folgende Fragen:

  • Wie haben Sie ihr jetziges Wissen entdeckt?
  • Haben Sie ihre Ideen mit jemandem während der Aktivität diskutiert? Was genau haben Sie diskutiert?
  • Wie haben Sie überprüft, ob ihre Hypothesen korrekt waren?
  • Haben Sie einige ihrer Ausgangshypothesen widerrufen? Welche?
  • Wie haben Sie widersprüchliche Auswertungen innerhalb oder zwischen den Gruppen aufgelöst?
  • Waren all ihre Auswertungen und Lösungen gleich stark?

Erklären Sie ihren Schülerinnen und Schülern nach der Diskussion, dass die Sequenzen DNA- und Aminosäuresequenzen waren und dass sie gerade ein echtes Schlüsselexperiment der Molekularbiologie reproduziert haben. Ihre Lernenden sollten nun motiviert sein, mehr über den genetischen Code und das zentrale Dogma der Molekularbiologie zu lernen, inklusive der Einsicht, wie ähnlich ihre Aktivität zu der Art und Weise war, wie der genetische Code wirklich geknackt wurde.

Sie sollten die Aktivität zusammenfassen, indem Sie ihre Lernenden daran erinnern, was sie für sich selbst entdeckt haben:

  • Schritt 1: der genetische Code basiert auf Nucleotidtripletts (Codons).
  • Schritt 2: der genetische Code ist redundant, aber nicht mehrdeutig: jedes Codon codiert für ein einzelnes Element (z.B. eine Aminosäure), aber einige Elemente werden von mehr als einem Codon codiert.
  • Schritt 3: Der Code beinhaltet Start- und Stopp-Codons, um den Anfang und das Ende der kodierten Aminosäuresequenz zu verdeutlichen.

(Bedenken Sie, dass die Aktivität die Fehlvorstellung hervorrufen könnte, dass Proteine meistens aus sechs oder sieben Aminosäuren aufgebaut sind. Dies könnte noch angesprochen werden.)

Machen Sie deutlich, dass die Arbeitsweise, in denen ihre Lernenden gearbeitet haben, nämlich die Arbeit in sich verändernden Teams, die gleichzeitig zusammenarbeiten und konkurrieren und der Weitergabe von Informationen an die anderen Teams, die Art und Weise darstellen, in der Wissenschaftler auch im echten Leben arbeiten.

Alternativen

Um die Aktivität etwas einfacher zu machen, können Sie ihren Schülerinnen und Schülern mehr Sequenzen in jedem Schritt zur Verfügung stellen (z.B. die Sequenzsets von zwei Gruppen). Alternativ könnten Sie Schritt 3 auslassen und lediglich am Ende der Aktivität erklären, welche Rolle das Start- und Stopp-Codon haben.

Danksagung

Pädagogische Reflexionen zu Aktivitäten wie der aus diesem Artikel sind ein Teil der Arbeit der Forschungsgruppe LICEC (llenguatge i contextos en educació científica, Sprache und Kontext in der wissenschaftlichen Bildung) an der Freien Universität Barcelona (Referenznummer 2014SGR1492), finanziert vom Spanischen Ministerium für Wirtschaft und Wettbewerb (Referenznummer EDU2015-66643-C2-1-P)

Download

Download this article as a PDF

Web References

Resources

  • Diese Aktivität ist Teil des C3 science education project, was problemorientierte, forschend-entdeckende Lernaktivtäten entwicklet, um das naturwissenschaftliche Curriculum zu bedienen.
  • Andere englischsprachige Aktivitäten innerhalb es Programms thematisieren Plattentektonik, Mitose und Krebs, Humanevolution, Phylogenese, genetische Erbschaft, Genexpression und Ökosystemdynamik.
  • Siehe außerdem:
  • Domènech-Casal J (2013) Hacking the code: una aproximació indagadora a l’ensenyament del codi genètic, o seguint les passes de Nirenberg i Khorana. Ciències: revista del professorat de ciències de primària i secundària 25: 20-25
  • Domènech-Casal J (in press) Proyectando BioGeo, un itinerario de trabajo por proyectos contextualizados basado en la indagación y la Naturaleza de la Ciencia. Alambique, Didáctica de las Ciencias Experimentales
  • Nirenberg M, et al (1965) RNA codewords and protein synthesis, VII. On the general nature of the RNA code. Proceedings of the National Academy of Sciences of the USA 53(5): 1161–1168
  • Der Artikel kann kostenlos von der Pubmed Central Website heruntergeladen werden.
  • Lies die Geschichte ‘wie der Code geknackt wurde’ auf der Homepage des Nobelpreises. 
  • Im Jahr 1968 wurde Marshall W Nirenberg, Har Gobind Khorana und Robert W Holley „für ihre Interpretation des genetischen Codes und seiner Funktion bei der Proteinsynthese“ der Nobelpreis für Physiologie oder Medizin verliehen. Detaillierte Informationen zu ihrer Arbeit sind  in der Präsentationsrede beschrieben.
  • Francis Crick, James Watson und Maurice Wilkins wurde im Jahr 1962 der Nobelpreis für Physiologie oder Medizin verliehen ‘für ihre Entdeckungen zur molekularen Struktur der Nukleinsäuren und ihrer Bedeutung für die Informationsweitergabe in lebendem Material’. 
  • Im Jahre 1970 beschrieb Francis Crick, wie das zentrale Dogma der Molekularbiologie entwickelt wurde.
  • Crick F (1970) Central dogma of molecular biology. Nature 227: 561-563. doi:10.1038/227561a0
  • Viele Publikationen von Crick sind kostenlos auf der Nature Website verfügbar. Siehe: www.nature.com

Author(s)

Jordi Domènech-Casal besitzt einen Doktortitel in Biologie und arbeitete acht Jahre als Forscher in der Genetik und der anorganischen Chemie an den Universitäten Barcelona( Spanien), Bologna (Italien) und Paris VII (Frankreich). Im Augenblick arbeitet er als Lehrer der Naturwissenschaften am Institut de Granollers, einer Sekundärschule in Barcelona, in der Lehrerausbildung und als wissenschaftlicher Berater der katalanischen Regierung, sowie am europäischen Projekt ‘Engaging Science’. Er ist Mitglied der Forschungsgruppe llenguatge i ensenyament de les ciències, LIEC an der Freien Universität Barcelona, wo seine Interessen vor allem auf die Rolle von Sprache und Kontext im forschend-entdeckendem und problemorientiertem Lernen im naturwissenschaftlichen Kontext liegen.


Review

Dieser Artikel bietet Lehrern eine einfache und zugängliche Strategie, eine der herausforderndsten Aspekte des naturwissenschaftlichen Unterrichts zu entdecken: ihren Lernenden zu vermitteln, wie wissenschaftliches Arbeiten wirklich funktioniert. Der Wissenserwerb erfordert das Stellen guter Fragen, die Planung und Durchführung guter Experimente, und die Zusammenarbeit bei der Überprüfung von Unsicherheiten. Genau dies wird von den Schülerinnen und Schülern bei dieser Aktivität erwartet, wenn sie den genetischen Code knacken.

Ich gehe davon aus, dass Lehrer anderer Disziplinen als der Biologie (insbesondere der Mathematik und Chemie) diesen Artikel ebenfalls nützlich finden werden. Es wäre ebenfalls eine sehr gute Aktivität für eine Wissenschaftsmesse.


Betina Lopes, Portugal




License

CC-BY
CC BY